Stem-loop sequence bna-MIR860

AccessionMI0020292 (change log)
DescriptionBrassica napus miR860 stem-loop
Gene family MIPF0001176; MIR860
Literature search

2 open access papers mention bna-MIR860
(4 sentences)

Stem-loop
   -        u                   c       g    --ag    c      u 
5'  uggucaag guaauguauguaguccaau uauugaa uacu    caca caucuc a
    |||||||| ||||||||||||||||||| ||||||| ||||    |||| ||||||  
3'  acuaguuu cauuauauacaucagguua auaacuu auga    gugu guagag g
   a        u                   c       g    guug    a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:CA991770: 133-247 [+]
intergenic
EM:EE553293: 196-310 [+]
intergenic
EM:ES901619: 307-421 [+]
intergenic
EM:ES932936: 472-586 [+]
intergenic
EM:EV222747: 188-302 [-]
intergenic
Database links

Mature sequence bna-miR860

Accession MIMAT0023645
Sequence

80 - 

ucaauacauuggacuacauau

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1