Stem-loop sequence bna-MIR403

AccessionMI0020291 (change log)
DescriptionBrassica napus miR403 stem-loop
Gene family MIPF0000290; MIR403
Literature search

3 open access papers mention bna-MIR403
(5 sentences)

Stem-loop
   agag     u  u     au    u                  uau  ucau    u 
5'     aagag ca auuac  guuu gugcgugaaucuaauucg   gc    guag a
       ||||| || |||||  |||| ||||||||||||||||||   ||    |||| a
3'     uuuuc gu uaaug  caaa cacgcacuuagauuaggu   ug    uauc u
   ----     u  c     cu    -                  ugu  -uuc    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189416: 25604-25714 [+]
intergenic
Database links

Mature sequence bna-miR403

Accession MIMAT0023644
Sequence

78 - 

uuagauucacgcacaaacucg

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1