Stem-loop sequence bna-MIR399c

AccessionMI0020290 (change log)
DescriptionBrassica napus miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention bna-MIR399c
(11 sentences)

Stem-loop
        a     a               ga u -      uucagucuu      g 
5' auuac gggca gaucuccuuuggcag  a c cauuac         acauau c
   ||||| ||||| |||||||||||||||  | | ||||||         ||||||  
3' uaaug ccugu uuagaggaaaccguc  u g guggug         uguaua a
        g     -               uc c a      -------uu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH538972: 179-281 [+]
intergenic
Database links

Mature sequence bna-miR399c

Accession MIMAT0023643
Sequence

79 - 

ugccaaaggagauuuguccgg

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1