Stem-loop sequence bna-MIR399b

AccessionMI0020289 (change log)
DescriptionBrassica napus miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention bna-MIR399b
(11 sentences)

Stem-loop
        a     a       a       ga   -      uu   cuu     cu 
5' auuac gggca gaucucu uuggcag  aac cauuac  gac   ugcau  c
   ||||| ||||| ||||||| |||||||  ||| ||||||  |||   |||||   
3' uaaug cccgu uuagagg aaccguc  uug gugaug  uug   acgua  u
        g     -       a       uc   a      uu   -uu     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189240: 96538-96644 [+]
intergenic
Database links

Mature sequence bna-miR399b

Accession MIMAT0023642
Sequence

83 - 

ugccaaaggagauuugcccgg

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1