Stem-loop sequence bna-MIR395f

AccessionMI0020288 (change log)
DescriptionBrassica napus miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bna-MIR395f
(18 sentences)

Stem-loop
      c   u         uu         u      -g  -     -    uaau 
5' guc ucu gaguucccu  aacgcuuca uguuca  ac uuggu uguc    a
   ||| ||| |||||||||  ||||||||| ||||||  || ||||| ||||    u
3' cgg gga cucaggggg  uugugaagu acaagu  ug aacua auag    c
      u   u         gu         c      aa  c     c    ccau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH944178: 47-154 [+]
intergenic
Database links

Mature sequence bna-miR395f

Accession MIMAT0023641
Sequence

80 - 

cugaaguguuuggggggacuc

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1