Stem-loop sequence bna-MIR395e

AccessionMI0020287 (change log)
DescriptionBrassica napus miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bna-MIR395e
(18 sentences)

Stem-loop
     -   u         g          u         c  a   guu 
5' cc ccu gaguucccu aaacgcuuca uguucauua gu gau   u
   || ||| ||||||||| |||||||||| ||||||||| || |||   a
3' gg gga cucaggggg uuugugaagu acaaguaau ua cua   g
     u   u         g          c         c  a   aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bna-miR395e

Accession MIMAT0023640
Sequence

69 - 

cugaaguguuuggggggacuc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1