Stem-loop sequence bna-MIR395d

AccessionMI0020286 (change log)
DescriptionBrassica napus miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bna-MIR395d
(19 sentences)

Stem-loop
     cc             uu         u   -gau   --------u    uc       uu 
5' gc  ccaugaguucccu  aacgcuuca ugu    uac         ccag  acauuua  u
   ||  |||||||||||||  ||||||||| |||    |||         ||||  |||||||  u
3' cg  ggugcucaggggg  uugugaagu aca    aug         gguu  uguaaau  u
     -u             gu         c   acau   uuuuuagcu    --       uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189385: 85486-85602 [+]
intergenic
Clustered miRNAs
< 10kb from bna-MIR395d
bna-MIR395aEM:AC189385: 84299-84381 [-]
bna-MIR395dEM:AC189385: 85486-85602 [+]
Database links

Mature sequence bna-miR395d

Accession MIMAT0023639
Sequence

90 - 

cugaaguguuuggggggacuc

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1