Stem-loop sequence bna-MIR395c

AccessionMI0020285 (change log)
DescriptionBrassica napus miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bna-MIR395c
(18 sentences)

Stem-loop
   u uu   ua         ug         u    uaua      u  au 
5'  g  ucc  gaguuccuc  agcacuuca ugga    acauuu cu  c
    |  |||  |||||||||  ||||||||| ||||    |||||| ||  a
3'  c  agg  cucaagggg  uugugaagu aucu    uguaaa ga  a
   a uc   uc         gu         c    --ua      -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DU121509: 559-656 [-]
intergenic
Database links

Mature sequence bna-miR395c

Accession MIMAT0023638
Sequence

69 - 

cugaaguguuugggggaacuc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1