Stem-loop sequence bna-MIR395b

AccessionMI0020284 (change log)
DescriptionBrassica napus miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bna-MIR395b
(18 sentences)

Stem-loop
      ua         ug         u     a   c    auuu 
5' ucc  gaguuccuc  agcacuuca uggag uac guuu    u
   |||  |||||||||  ||||||||| ||||| ||| ||||    c
3' agg  cucaagggg  uugugaagu accuu aug uaaa    u
      uc         gu         c     -   -    acua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BZ089005: 379-467 [-]
intergenic
Database links

Mature sequence bna-miR395b

Accession MIMAT0023637
Sequence

64 - 

cugaaguguuugggggaacuc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1