Stem-loop sequence bna-MIR395a

AccessionMI0020283 (change log)
DescriptionBrassica napus miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention bna-MIR395a
(18 sentences)

Stem-loop
      ua         ug         u      uacaa    u 
5' ucc  gaguuccuc  agcacuuca ugggua     uuuc u
   |||  |||||||||  ||||||||| ||||||     ||||  
3' agg  cucaagggg  uugugaagu acccau     gaag a
      uc         gu         c      ---ua    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189385: 84299-84381 [-]
intergenic
EM:BH697187: 94-176 [+]
intergenic
Clustered miRNAs
< 10kb from bna-MIR395a
bna-MIR395dEM:AC189385: 85486-85602 [+]
bna-MIR395aEM:AC189385: 84299-84381 [-]
Database links

Mature sequence bna-miR395a

Accession MIMAT0023636
Sequence

58 - 

cugaaguguuugggggaacuc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1