Stem-loop sequence bna-MIR394b

AccessionMI0020282 (change log)
DescriptionBrassica napus miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

4 open access papers mention bna-MIR394b
(77 sentences)

Stem-loop
   --uu     ga   -      u c              -------  - u     u   u 
5'     acaga  ucu uuggca u uguccaccuccccu       ac c augua aug g
       |||||  ||| |||||| | ||||||||||||||       || | ||||| ||| u
3'     ugucu  aga aaccgu a acggguggaggggg       ug g ugcau uau a
   ggau     ag   c      c u              aguguuu  u u     c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189295: 85927-86038 [+]
intergenic
Database links

Mature sequence bna-miR394b

Accession MIMAT0023635
Sequence

13 - 

uuggcauucuguccaccucc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1