Stem-loop sequence bna-MIR394a

AccessionMI0020281 (change log)
DescriptionBrassica napus miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

4 open access papers mention bna-MIR394a
(93 sentences)

Stem-loop
   --     g    -      u c             u --u       -----u        a 
5'   acaga uucu uuggca u uguccaccuccuu c   gaauaua      uuguguau a
     ||||| |||| |||||| | ||||||||||||| |   |||||||      ||||||||  
3'   ugucu gaga aaccgu a acggguggaggag g   uuugugu      aacgcaug g
   au     a    u      c u             u ugu       ugcauc        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189318: 31776-31891 [+]
intergenic
Database links

Mature sequence bna-miR394a

Accession MIMAT0023634
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1