Stem-loop sequence bna-MIR172a

AccessionMI0020280 (change log)
DescriptionBrassica napus miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

13 open access papers mention bna-MIR172a
(48 sentences)

Stem-loop
   uu    a gc      c           a    gaa  uga     cu      u 
5'   uugu g  gcagca caucaagauuc caug   au   aaaau  ccuaau u
     |||| |  |||||| ||||||||||| ||||   ||   |||||  |||||| u
3'   aaca c  cgucgu guaguucuaag guau   ua   uuuug  ggauua u
   -c    a ua      a           a    aug  uag     --      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189388: 19381-19490 [-]
intergenic
Database links

Mature sequence bna-miR172a

Accession MIMAT0023633
Sequence

83 - 

agaaucuugaugaugcugcau

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1