Stem-loop sequence bna-MIR172c

AccessionMI0020279 (change log)
DescriptionBrassica napus miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

12 open access papers mention bna-MIR172c
(46 sentences)

Stem-loop
   c     -   gu   a                     a  ag   a u  uu     g       ccuc 
5'  agccg gua  ugc gaugcagcaucaucaagauuc ca  uga g gg  uccuu guuuucg    u
    ||||| |||  ||| ||||||||||||||||||||| ||  ||| | ||  ||||| |||||||     
3'  ucggu cau  acg cuacgucguaguaguucuaag gu  gcu c uc  gggaa caaaagc    c
   a     a   au   a                     g  aa   - u  uu     a       cuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189559: 3489-3626 [+]
intergenic
EM:ED525000: 196-333 [-]
intergenic
Database links

Mature sequence bna-miR172c

Accession MIMAT0023632
Sequence

101 - 

ggaaucuugaugaugcugcau

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1