Stem-loop sequence bna-MIR172b

AccessionMI0020278 (change log)
DescriptionBrassica napus miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

12 open access papers mention bna-MIR172b
(47 sentences)

Stem-loop
          a                     a      a  u  uuuu 
5' uaguugc gaugcagcaucauuaagauuc caagag ug gg    c
   ||||||| ||||||||||||||||||||| |||||| || ||    u
3' aucaacg cuacgucguaguaguucuaag guucuc gc cu    u
          a                     g      c  u  uuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189648: 23979-24073 [-]
intergenic
EM:DX011558: 214-308 [-]
intergenic
EM:DX078594: 205-299 [-]
intergenic
EM:ED520082: 222-316 [-]
intergenic
EM:ED526567: 222-316 [-]
intergenic
Database links

Mature sequence bna-miR172b

Accession MIMAT0023631
Sequence

66 - 

ggaaucuugaugaugcugcau

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1