Stem-loop sequence bna-MIR172d

AccessionMI0020277 (change log)
DescriptionBrassica napus miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

12 open access papers mention bna-MIR172d
(46 sentences)

Stem-loop
   --uuu    ua     u              ag      uauuccuu         uc 
5'      uugc  uugca caucaucaagauuc  aaauca        gauggguuc  c
        ||||  ||||| ||||||||||||||  ||||||        |||||||||   
3'      agcg  gacgu guaguaguucuaag  uuuggu        cuguccgag  u
   aaauu    gc     c              ag      ---uuuuu         cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189487: 133692-133804 [+]
intergenic
Database links

Mature sequence bna-miR172d

Accession MIMAT0023630
Sequence

82 - 

agaaucuugaugaugcugcag

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1