Stem-loop sequence bna-MIR169n

AccessionMI0020276 (change log)
DescriptionBrassica napus miR169n stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

11 open access papers mention bna-MIR169n
(44 sentences)

Stem-loop
   --agaa        a      u      u    c    -    au            gguc         g  uaa 
5'       uugcauga guggag agagua aaug agcc aagg  gacuugccggag    guucaucau ca   u
         |||||||| |||||| |||||| |||| |||| ||||  ||||||||||||    ||||||||| ||   a
3'       aacguacu caucuu ucucgu uuac ucgg uucc  uugaacggucuu    caaguagug gu   a
   cucuca        -      c      u    a    c    cg            aaua         -  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bna-miR169n

Accession MIMAT0023629
Sequence

32 - 

cagccaaggaugacuugccgg

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1