Stem-loop sequence bna-MIR168b

AccessionMI0020275 (change log)
DescriptionBrassica napus miR168b stem-loop
Gene family MIPF0000081; MIR168
Literature search

8 open access papers mention bna-MIR168b
(17 sentences)

Stem-loop
   acc   -uu    g      c          u  a  a      g cuaa    -u   cg   u 
5'    guc   gcuc gauucg uuggugcagg cg ga cuaauu u    caca  cca  aag u
      |||   |||| |||||| |||||||||| || || |||||| |    ||||  |||  ||| u
3'    uag   cgag cuaagu aacuacguuc gc cu gguuag g    gugu  ggu  uuc u
   -gc   ucc    g      u          c  c  a      g acga    uu   cg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:EV007136: 150-279 [+]
intergenic
Database links

Mature sequence bna-miR168b

Accession MIMAT0023628
Sequence

17 - 

ucgcuuggugcaggucgagaa

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1