Stem-loop sequence bna-MIR167d

AccessionMI0020274 (change log)
DescriptionBrassica napus miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

9 open access papers mention bna-MIR167d
(32 sentences)

Stem-loop
   ----------u      a gc         c  c        u    aga 
5'            uuuggg g  ugaagcugc ag augaucug guau   u
              |||||| |  ||||||||| || |||||||| ||||    
3'            aaacuc c  acuucggcg uc uacuagac caug   a
   uaacaaccacu      a uu         -  c        -    gug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DY023882: 199-288 [+]
intergenic
Database links

Mature sequence bna-miR167d

Accession MIMAT0023627
Sequence

12 - 

ugaagcugccagcaugaucu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1