Stem-loop sequence bna-MIR166e

AccessionMI0020273 (change log)
DescriptionBrassica napus miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention bna-MIR166e
(35 sentences)

Stem-loop
   uucuu            uu      ca   g c c     a  gaucuac     g          
5'      uugaggggaaug  gucugg  cga g c uuaac ca       gaucg uuauauaua 
        ||||||||||||  ||||||  ||| | | ||||| ||       ||||| |||||||| u
3'      aacuccccuuac  cggacc  gcu c g aguug gu       cuagc aguauauaa 
   acauu            uu      ag   g a u     -  gauuuaa     a          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bna-miR166e

Accession MIMAT0023626
Sequence

101 - 

ucggaccaggcuucauucccc

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1