Stem-loop sequence bna-MIR166f

AccessionMI0020272 (change log)
DescriptionBrassica napus miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention bna-MIR166f
(33 sentences)

Stem-loop
   ---a    a    a   uu      a         uua        --------       --    aua 
5'     guug gggg aug  gucugg ucgaggaua   uauauaca        caaauac  guau   u
       |||| |||| |||  |||||| |||||||||   ||||||||        |||||||  ||||    
3'     caau cccc uac  cggacc ggcucuuau   auauaugu        guuugug  caua   g
   ugua    c    c   uu      a         uag        auauacua       aa    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH938609: 442-570 [+]
intergenic
Database links

Mature sequence bna-miR166f

Accession MIMAT0023625
Sequence

100 - 

ucggaccaggcuucauccccc

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1