Stem-loop sequence bna-MIR164d

AccessionMI0020271 (change log)
DescriptionBrassica napus miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

9 open access papers mention bna-MIR164d
(13 sentences)

Stem-loop
   --------guau   u  c     a  c              caaauga      g   ua 
5'             cac ug uggag ag agggcacgugcgaa       guuuga cag  c
               ||| || ||||| || ||||||||||||||       |||||| |||   
3'             gug ac accuc uc ucuugugcacgcuu       uaaacu guu  a
   cuuccccucuau   c  a     a  a              ------a      a   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189657: 106780-106889 [+]
intergenic
Database links

Mature sequence bna-miR164d

Accession MIMAT0023624
Sequence

12 - 

uggagaagcagggcacgugcg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1