Stem-loop sequence bna-MIR164c

AccessionMI0020270 (change log)
DescriptionBrassica napus miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

9 open access papers mention bna-MIR164c
(15 sentences)

Stem-loop
   aacacu  c     a  c              cua    ga   cug 
5'       ug uggag ag agggcacgugcgaa   auga  gau   u
         || ||||| || ||||||||||||||   ||||  |||    
3'       ac accuc uc ucuugugcacguuu   uacu  uug   g
   -----c  a     a  a              uua    ag   uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189626: 18955-19045 [+]
intergenic
Database links

Mature sequence bna-miR164c

Accession MIMAT0023623
Sequence

10 - 

uggagaagcagggcacgugcg

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1