Stem-loop sequence bna-MIR164b

AccessionMI0020269 (change log)
DescriptionBrassica napus miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

10 open access papers mention bna-MIR164b
(14 sentences)

Stem-loop
   --------gu     u  c     a  c              ca    a       cgg 
5'           uacac ug uggag ag agggcacgugcgaa  aaug gaucgau   u
             ||||| || ||||| || ||||||||||||||  |||| |||||||    
3'           gugug ac accuc uc ucuugugcacgcuu  uuau cuaguug   a
   cucccccucc     c  a     a  a              --    a       uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189579: 62367-62476 [+]
intergenic
Database links

Mature sequence bna-miR164b

Accession MIMAT0023622
Sequence

12 - 

uggagaagcagggcacgugcg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1