Stem-loop sequence bna-MIR162a

AccessionMI0020268 (change log)
DescriptionBrassica napus miR162a stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

5 open access papers mention bna-MIR162a
(6 sentences)

Stem-loop
   ------a    aaga       g   gc    g        c  ug  --ggaau     a 
5'        guga    ugcugga gca  gguu aucgaucu uu  ug       uuuug a
          ||||    ||||||| |||  |||| |||||||| ||  ||       ||||| a
3'        cgcu    gcgaccu cgu  ccaa uagcuaga aa  ac       aaaac a
   acuucuc    ---g       a   gu    a        c  gu  gaaaauu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189332: 84098-84211 [-]
intergenic
EM:ED527680: 868-981 [+]
intergenic
EM:EX071254: 614-727 [-]
intergenic
EM:EX133401: 406-519 [+]
intergenic
Database links

Mature sequence bna-miR162a

Accession MIMAT0023621
Sequence

80 - 

ucgauaaaccugugcauccag

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1