Stem-loop sequence bna-MIR160d

AccessionMI0020267 (change log)
DescriptionBrassica napus miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

10 open access papers mention bna-MIR160d
(45 sentences)

Stem-loop
          c     c -           a   aaaua     c  a 
5' gucaugc uggcu c cuguaugccac agu     ccgau uc u
   ||||||| ||||| | ||||||||||| |||     ||||| || u
3' caguacg acuga g gacaugcggug uca     ggcua ag a
          a     u a           a   ---ca     a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC183492: 98296-98384 [+]
intergenic
Database links

Mature sequence bna-miR160d

Accession MIMAT0023620
Sequence

5 - 

ugccuggcucccuguaugcca

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1