Stem-loop sequence bna-MIR160c

AccessionMI0020266 (change log)
DescriptionBrassica napus miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

10 open access papers mention bna-MIR160c
(46 sentences)

Stem-loop
   gugugu   cuua         c     c -           a   aua   c   c     
5'       gcu    uggucgugc uggcu c cuguaugccac agu   uac gau ucgu 
         |||    ||||||||| ||||| | ||||||||||| |||   ||| ||| ||| u
3'       cga    accaguacg acuga g gacaugcggug ucg   gug cua agca 
   -cuuuu   ---a         a     u a           a   ---   u   a     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189471: 747-861 [+]
intergenic
Database links

Mature sequence bna-miR160c

Accession MIMAT0023619
Sequence

20 - 

ugccuggcucccuguaugcca

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1