Stem-loop sequence bna-MIR160b

AccessionMI0020265 (change log)
DescriptionBrassica napus miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

10 open access papers mention bna-MIR160b
(45 sentences)

Stem-loop
         c       c          aa    auau       gg 
5' ucaugc uggcucc uguaugccac  guag    ugauuuu  u
   |||||| ||||||| ||||||||||  ||||    |||||||  u
3' aguacg acugagg acaugcggug  cguc    acuaaaa  g
         a       a          ac    ---g       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189245: 14506-14593 [-]
intergenic
Database links

Mature sequence bna-miR160b

Accession MIMAT0023618
Sequence

4 - 

ugccuggcucccuguaugcca

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1