Stem-loop sequence bna-MIR160a

AccessionMI0020264 (change log)
DescriptionBrassica napus miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

10 open access papers mention bna-MIR160a
(50 sentences)

Stem-loop
   -    u      a  ugu      c       cu         c u ua  c         
5'  guag uguaua ga   guaugc uggcucc  guaugccau c c  ag ucaucgac 
    |||| |||||| ||   |||||| |||||||  ||||||||| | |  || ||||||| c
3'  cauu acauau cu   uauacg accgagg  uaugcggua g g  uc aguaguua 
   a    u      a  -uu      u       ag         a u cc  c         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189270: 107472-107590 [+]
intergenic
EM:EX025484: 306-424 [+]
intergenic
Database links

Mature sequence bna-miR160a

Accession MIMAT0023617
Sequence

21 - 

ugccuggcucccuguaugcca

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1