Stem-loop sequence bna-MIR156g

AccessionMI0020263
DescriptionBrassica napus miR156g stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -cgu    -    u           -            u  -uga      auuu  a 
5'     ugau agug ugacagaagau agagagcacaga ga    gaugca    gg g
       |||| |||| ||||||||||| |||||||||||| ||    ||||||    || c
3'     auug ucac acugucuucug ucucucguguuu cu    cuacgu    uc a
   guuc    c    u           a            c  caug      augu  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence bna-miR156g

Accession MIMAT0023616
Sequence

12 - 

uugacagaagauagagagcac

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1