Stem-loop sequence bna-MIR156f

AccessionMI0020262
DescriptionBrassica napus miR156f stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -----  -   -a   a         -   -         a   ---        u   u 
5'      ca cac  gaa uugacagaa gag agugagcac caa   aaguaaau gca a
        || |||  ||| ||||||||| ||| ||||||||| |||   |||||||| ||| u
3'      gu gug  cuu gacugucuu cuc ucacucgug guu   uucguuua cgu g
   cucua  c   cc   a         u   g         c   cuc        -   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:CV432746: 228-337 [+]
intergenic

Mature sequence bna-miR156f

Accession MIMAT0023615
Sequence

12 - 

ugacagaagagagugagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1