Stem-loop sequence bna-MIR156e

AccessionMI0020261
DescriptionBrassica napus miR156e stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   gaaaugcaaca     -------           -     -       u    ag   cu     gu 
5'            gagaa       aacugacagaa gagag ugagcac ugca  gca  guuau  g
              |||||       ||||||||||| ||||| ||||||| ||||  |||  |||||   
3'            cucuu       uugacugucuu cucuc acucgug gugu  cgu  caaua  u
   -------uucg     caguccg           u     c       c    -g   uu     ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189375: 124714-124832 [+]
intergenic
EM:DU831758: 290-408 [-]
intergenic

Mature sequence bna-miR156e

Accession MIMAT0023614
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1