Stem-loop sequence bna-MIR156d

AccessionMI0020260
DescriptionBrassica napus miR156d stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ------c  aaa   a        -    -         a   ---     cuu     g 
5'        gc   gaa cugacaga agag agugagcac caa   aggca   ugcau u
          ||   ||| |||||||| |||| ||||||||| |||   |||||   ||||| u
3'        cg   cuu gacugucu ucuc ucacucgug guu   uucgu   acgua c
   uuagcca  -gc   g        a    g         c   cuc     -uu     g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence bna-miR156d

Accession MIMAT0023613
Sequence

12 - 

ugacagaagagagugagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1