Stem-loop sequence stu-MIR6025

AccessionMI0020255 (change log)
DescriptionSolanum tuberosum miR6025 stem-loop
Gene family MIPF0001375; MIR6025
Literature search

2 open access papers mention stu-MIR6025
(7 sentences)

Stem-loop
   --uuc           cug    a      a             u     ug     -c     auua  u  u       uu 
5'      uuugccuaauu   guau ccaaca uugagauaacauc agguu  augau  uuuug    gc aa uguauag  a
        |||||||||||   |||| |||||| ||||||||||||| |||||  |||||  |||||    || || |||||||  u
3'      aaauggguuaa   cgua gguugu gacucuauuguag uccaa  uauua  aaaac    cg uu acauguc  c
   uauuu           aua    c      -             u     gu     uu     ---a  -  c       ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137842.1: 2036023-2036183 [-]
intergenic
Database links

Mature sequence stu-miR6025

Accession MIMAT0023608
Sequence

21 - 

uaccaacaauugagauaacauc

 - 42

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).