Stem-loop sequence nta-MIR6025b

AccessionMI0020254 (change log)
DescriptionNicotiana tabacum miR6025b stem-loop
Gene family MIPF0001375; MIR6025
Literature search

1 open access papers mention nta-MIR6025b
(2 sentences)

Stem-loop
   aaagua   uugu                   -          aua gu            aucugaucaaaaauauuuucuga 
5'       uug    accuggauguuaucucagu guuggcaugc   a  uggguaagacau                       g
         |||    ||||||||||||||||||| ||||||||||   |  ||||||||||||                        
3'       agc    uggaucuacaguagaguua caaccguacg   u  auccauuuugug                       a
   ------   uguu                   u          gac ug            guuuuauauauauaagguagagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6025b

Accession MIMAT0023607
Sequence

130 - 

ugccaacuauugagaugacauc

 - 151

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).