Stem-loop sequence nta-MIR482b

AccessionMI0020252 (change log)
DescriptionNicotiana tabacum miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention nta-MIR482b
(3 sentences)

Stem-loop
   --guguuuaa       uuu           -ag         a   -uau     uu 
5'           gggagcu   ggagugggugg   ugguaagau uca    uuaug  g
             |||||||   |||||||||||   ||||||||| |||    |||||   
3'           ccuucgg   ccuuaccuacc   accguucua agu    aauac  a
   ucuuuacuaa       uau           gua         a   uaau     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR482b-5p

Accession MIMAT0023604
Sequence

21 - 

aguggguggagugguaagaua

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence nta-miR482b-3p

Accession MIMAT0023605
Sequence

73 - 

ucuugccaaugccauccauucc

 - 94

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).