Stem-loop sequence sly-MIR482b

AccessionMI0020250 (change log)
DescriptionSolanum lycopersicum miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

22 open access papers mention sly-MIR482b
(345 sentences)

Stem-loop
   ggaaagggauga   uu  -ug       uuu      a      -   a     ag   -       u 
5'             aga  uu   ggaagcu   ggcgug gcggug ggg aagau  auc uaucaua u
               |||  ||   |||||||   |||||| |||||| ||| |||||  ||| |||||||  
3'             ucu  ag   ccuucgg   ccguac cgccac ucc uucua  uag auaguau a
   ------------   uu  uaa       uac      c      a   g     aa   u       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 37380417-37380541 [-]
intergenic
Clustered miRNAs
< 10kb from sly-MIR482b
sly-MIR482cchr6: 37388175-37388285 [-]
sly-MIR482bchr6: 37380417-37380541 [-]
sly-MIR482dchr6: 37380095-37380240 [-]
Database links

Mature sequence sly-miR482b

Accession MIMAT0023602
Sequence

84 - 

ucuugccuacaccgcccaugcc

 - 105

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).