Stem-loop sequence stu-MIR482d

AccessionMI0020248 (change log)
DescriptionSolanum tuberosum miR482d stem-loop
Gene family MIPF0000403; MIR482
Literature search

9 open access papers mention stu-MIR482d
(41 sentences)

Stem-loop
   --aauuuuug     cuuuu      a      -         aga  -      a 
5'           ggaag     ggcgug guggug ggguaagau   uc uaucau u
             |||||     |||||| |||||| |||||||||   || ||||||  
3'           ccuuc     ccguac cgccac uccguucua   ag auagua u
   ucuuuauuaa     uauac      c      a         aaa  u      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138014.1: 531315-531424 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR482d
stu-MIR482bJH138014.1: 538021-538142 [-]
stu-MIR482dJH138014.1: 531315-531424 [-]
stu-MIR482cJH138014.1: 530969-531103 [-]
Database links

Mature sequence stu-miR482d-5p

Accession MIMAT0031162
Sequence

21 - 

cgugaguggugggguaagaua

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence stu-miR482d-3p

Accession MIMAT0023600
Sequence

69 - 

ucuugccuacaccgcccaugcc

 - 90

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).