Stem-loop sequence stu-MIR482b

AccessionMI0020245 (change log)
DescriptionSolanum tuberosum miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

8 open access papers mention stu-MIR482b
(38 sentences)

Stem-loop
   ----     uuu a       u          u  -ca         a   u    ug     c 
5'     gaaug   c gggagcu uuggaguggg gg   ugguaagau uca auuu  uuuuu a
       |||||   | ||||||| |||||||||| ||   ||||||||| ||| ||||  |||||  
3'     uuuac   g ccuucgg aaccuuaccc cc   gccauucua agu uaag  aaaaa u
   ccuc     --u a       u          c  uua         a   -    gu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138014.1: 538021-538142 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR482b
stu-MIR482eJH138014.1: 542533-542643 [-]
stu-MIR482bJH138014.1: 538021-538142 [-]
stu-MIR482dJH138014.1: 531315-531424 [-]
stu-MIR482cJH138014.1: 530969-531103 [-]
Database links

Mature sequence stu-miR482b-5p

Accession MIMAT0031160
Sequence

21 - 

ggaguggguggcaugguaaga

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence stu-miR482b-3p

Accession MIMAT0023597
Sequence

81 - 

uuaccgauuccccccauuccaa

 - 102

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).