Stem-loop sequence stu-MIR482c

AccessionMI0020244 (change log)
DescriptionSolanum tuberosum miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

8 open access papers mention stu-MIR482c
(42 sentences)

Stem-loop
      -    -uug       u    a           -        a    -a            -   u 
5' gag agau    ggaagcu uugg gugggugggau ggaaaaau ucgu  uuuauuuuuuuu ccu a
   ||| ||||    ||||||| |||| ||||||||||| |||||||| ||||  |||||||||||| |||  
3' cuc uuua    ccuucgg aacc uacccaccuua ccuuuuua agua  gaauagaaaaaa gga a
      a    cuaa       u    g           u        g    aa            c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138014.1: 530969-531103 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR482c
stu-MIR482bJH138014.1: 538021-538142 [-]
stu-MIR482dJH138014.1: 531315-531424 [-]
stu-MIR482cJH138014.1: 530969-531103 [-]
Database links

Mature sequence stu-miR482c

Accession MIMAT0023596
Sequence

94 - 

uuuccuauuccacccaugccaa

 - 115

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).