Stem-loop sequence sly-MIR6024

AccessionMI0020242 (change log)
DescriptionSolanum lycopersicum miR6024 stem-loop
Gene family MIPF0001459; MIR6024
Literature search

13 open access papers mention sly-MIR6024
(77 sentences)

Stem-loop
   ---aacu    aug      u  a        a             g    cc  ucau 
5'        ggaa   gggaag gg gaaacaac cuugcuaaaggaa uuca  ag    c
          ||||   |||||| || |||||||| ||||||||||||| ||||  ||    u
3'        ccuu   cucuuc cc uuuuguug gaacgauuuuuuu aggu  uc    c
   cucucug    -aa      u  a        a             g    uu  uuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 83238914-83239030 [-]
intergenic
Database links

Mature sequence sly-miR6024

Accession MIMAT0023594
Sequence

76 - 

uuuuagcaagaguuguuuuacc

 - 97

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).