Stem-loop sequence stu-MIR6024

AccessionMI0020241 (change log)
DescriptionSolanum tuberosum miR6024 stem-loop
Gene family MIPF0001459; MIR6024
Literature search

4 open access papers mention stu-MIR6024
(44 sentences)

Stem-loop
   --aaauu  uaa       u  ag       a             g    uc  -u  u 
5'        gg   ugggaag gg  aaacaac cuugcuaaaagaa uuca  ag  ga u
          ||   ||||||| ||  ||||||| ||||||||||||| ||||  ||  || c
3'        cc   acucuuc cc  uuuguug gaacgauuuuuuu aggu  uc  cu u
   cucucug  uua       u  cu       a             g    uu  uu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137968.1: 737039-737156 [-]
intergenic
Database links

Mature sequence stu-miR6024-5p

Accession MIMAT0031159
Sequence

21 - 

agaaacaacacuugcuaaaaga

 - 42

Get sequence
Evidence experimental; Illumina [2]

Mature sequence stu-miR6024-3p

Accession MIMAT0023593
Sequence

77 - 

uuuuagcaagaguuguuuuccc

 - 98

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).