Stem-loop sequence tca-mir-9e

AccessionMI0020231 (change log)
DescriptionTribolium castaneum miR-9e stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention tca-mir-9e
(3 sentences)

Stem-loop
   aacag    -ca        a  u   u     g   u      g     g   u 
5'      guug   agucggau ua ucu cuuug uga cuaguu uauga ugu u
        ||||   |||||||| || ||| ||||| ||| |||||| ||||| ||| u
3'      cagc   ucagcuua gu aga gaaac acu ggucga auacu aua a
   ccgag    uuc        c  u   c     g   u      a     -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 11062-11172 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-9e
tca-mir-279eChLG9: 11200-11294 [-]
tca-mir-9eChLG9: 11062-11172 [-]
tca-mir-2944cChLG9: 10955-11064 [-]
Database links

Mature sequence tca-miR-9e-5p

Accession MIMAT0023581
Sequence

27 - 

ucuuuggugaucuaguuguau

 - 47

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-9e-3p

Accession MIMAT0023582
Sequence

64 - 

auaaagcugguucagcaaagca

 - 85

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).