Stem-loop sequence tca-mir-927b

AccessionMI0020230 (change log)
DescriptionTribolium castaneum miR-927b stem-loop
Stem-loop
   cgccc     -  -  uu       u          c       u   ac 
5'      uuuga gc cc  ccgguuu agaaucugua gcuuugu guu  u
        ||||| || ||  ||||||| |||||||||| ||||||| |||  u
3'      aaauu ug gg  ggucaag ucuuaggcau cgagaca uaa  u
   ----c     a  a  -u       c          u       c   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 11142398-11142493 [-]
intergenic
Database links

Mature sequence tca-miR-927b-5p

Accession MIMAT0023579
Sequence

22 - 

uuuagaaucuguacgcuuugu

 - 42

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-927b-3p

Accession MIMAT0023580
Sequence

56 - 

ucacagagcuuacggauucucg

 - 77

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).