Stem-loop sequence tca-mir-6018

AccessionMI0020229 (change log)
DescriptionTribolium castaneum miR-6018 stem-loop
Stem-loop
   aaaca        --ca       u   -ug     aauaau    u 
5'      augguagg    gcuaguu caa   gaauu      uuuu u
        ||||||||    ||||||| |||   |||||      ||||  
3'      uaccaucc    ugaucag guu   cuuaa      aaaa a
   accuc        cagc       u   caa     gauaac    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 362657-362749 [-]
intergenic
Database links

Mature sequence tca-miR-6018-5p

Accession MIMAT0023577
Sequence

17 - 

cuaguuucaauggaauuaa

 - 35

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-6018-3p

Accession MIMAT0023578
Sequence

55 - 

uagaauucaacuugugacuag

 - 75

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).