Stem-loop sequence tca-mir-6017

AccessionMI0020228 (change log)
DescriptionTribolium castaneum miR-6017 stem-loop
Stem-loop
   auaag   uu     uucca  c      g uc        uau    u   --uuu    g    ------------       gu 
5'      agu  guugu     cc ugucgu u  cuaauugg   guug auu     uauu ggcu            gauucgu  u
        |||  |||||     || |||||| |  ||||||||   |||| |||     |||| ||||            |||||||  u
3'      uca  uaaca     gg acagua g  gauuaacc   uaac uaa     guga ccga            cugagua  a
   ucugg   uu     -----  c      g cu        --u    -   ucucc    g    accuauguccuu       gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 6907635-6907789 [-]
intergenic
Database links

Mature sequence tca-miR-6017-5p

Accession MIMAT0023575
Sequence

38 - 

uugguauguuguauuuuuua

 - 57

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-6017-3p

Accession MIMAT0023576
Sequence

106 - 

gccucuaaucaauuccaauu

 - 125

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).