Stem-loop sequence tca-mir-6016

AccessionMI0020227 (change log)
DescriptionTribolium castaneum miR-6016 stem-loop
Stem-loop
   gg  c        a  a  a     u      uauu 
5'   cg aagaguag ag ac ugugg cguggu    c
     || |||||||| || || ||||| ||||||    g
3'   gc uuuucauc uc ug acacc gcaccg    g
   ca  a        c  c  a     c      uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 14528165-14528239 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-6016
tca-mir-6016ChLG7: 14528165-14528239 [+]
tca-mir-6016bChLG7: 14528171-14528228 [-]
Database links

Mature sequence tca-miR-6016-5p

Accession MIMAT0023573
Sequence

12 - 

agaagaacauguggucgugguuau

 - 35

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-6016-3p

Accession MIMAT0023574
Sequence

46 - 

cacgcccacaaguccuccu

 - 64

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).