Stem-loop sequence tca-mir-6013

AccessionMI0020224 (change log)
DescriptionTribolium castaneum miR-6013 stem-loop
Stem-loop
   -  uc     -     caa   -   c  -ggaa  g 
5'  gc  aggcg ucguc   agc gcu ca     gc c
    ||  ||||| |||||   ||| ||| ||     ||  
3'  cg  uccgc agcag   ucg cga gu     cg a
   a  -u     c     ---   u   a  ggagc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 11065727-11065794 [-]
intergenic
Database links

Mature sequence tca-miR-6013-5p

Accession MIMAT0023567
Sequence

6 - 

ggcgucguccaaagcgcucc

 - 25

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-6013-3p

Accession MIMAT0023568
Sequence

48 - 

gcugcugacgaccgccuug

 - 66

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).