Stem-loop sequence tca-mir-6012

AccessionMI0020223 (change log)
DescriptionTribolium castaneum miR-6012 stem-loop
Gene family MIPF0001496; mir-6012
Literature search

1 open access papers mention tca-mir-6012
(1 sentences)

Stem-loop
   cgauu   a   g  --c  g      aa      -acaauc   ugg  u  a    -ga    a       ug  ucu  g      uuag 
5'      gug cug gu   ac uagagg  ggaaag       ugg   ug gc gggu   acag cugaucu  uu   gc gaaaug    u
        ||| ||| ||   || ||||||  ||||||       |||   || || ||||   |||| |||||||  ||   || ||||||    u
3'      cgc gac ua   ug aucucu  ucuuuc       gcu   gc cg ccca   uguc gacuaga  ag   cg cuuuac    a
   -----   -   g  uaa  -      --      acaacuu   uga  u  a    agc    c       gu  ---  g      ugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 6961931-6962103 [-]
intergenic
Database links

Mature sequence tca-miR-6012-5p

Accession MIMAT0023565
Sequence

63 - 

cugaucuuguuucugcgga

 - 81

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-6012-3p

Accession MIMAT0023566
Sequence

100 - 

uucggcgaugagaucagccuguc

 - 122

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).