Stem-loop sequence tca-mir-6010

AccessionMI0020221 (change log)
DescriptionTribolium castaneum miR-6010 stem-loop
Stem-loop
   auuu       u   uuuuu u       ua   -     gcgu 
5'     uuugcag uug     g cgccuuu  ggc acuug    a
       ||||||| |||     | |||||||  ||| |||||    u
3'     aaauguu agc     c gugggaa  ucg ugaac    u
   aacu       c   ----u -       ug   a     aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 9062069-9062153 [+]
intergenic
Database links

Mature sequence tca-miR-6010-5p

Accession MIMAT0023561
Sequence

11 - 

guuuguuuuugucgccuuuu

 - 30

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence tca-miR-6010-3p

Accession MIMAT0023562
Sequence

61 - 

uaagggugcucgacuugua

 - 79

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).